| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.002293 |
| Chromosome: | chromosome 13 |
| Location: | 1257478 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g570550 | CDD1 | Cytidine deaminase; (1 of 1) 3.5.4.5 - Cytidine deaminase / Cytosine nucleoside deaminase | 5'UTR |
| Cre13.g570600 | CTR1 | CTR type copper ion transporter; (1 of 2) K14686 - solute carrier family 31 (copper transporter), member 1 (SLC31A1, CTR1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGTTTGCAAGCCGTTCCCGCAGACCAAGTACGCTGAGGCTAAACTCA |
| Internal bar code: | CCAAAGCGAGGGGAGCCGCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1651 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGGCAAGATGGAAGAGGC |
| Suggested primer 2: | AATACCTCCTCCGGGCTCTT |