Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.002655 |
Chromosome: | chromosome 2 |
Location: | 1287691 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g082300 | SUR6 | (1 of 1) PF04935 - Surfeit locus protein 6 (SURF6); Surfeit 6-like protein | 3'UTR |
Cre02.g082350 | CUTA1,CUT1 | (1 of 1) K03926 - periplasmic divalent cation tolerance protein (cutA); Copper-binding protein CutA | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGTGCAGCGCTGCCACGTGCGTTCCATCCGCGAAGCTTGGGGGCCAG |
Internal bar code: | TACCCGAATAGTGTTTTACCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1799 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTAAACAACGCCAACAGGG |
Suggested primer 2: | CAGGATTGACGGTTGCTCCT |