| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.002667 |
| Chromosome: | chromosome 6 |
| Location: | 5386224 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285401 | HLP1,FAP355 | Histone-like Flagellar Associated protein; (1 of 1) PF00216 - Bacterial DNA-binding protein (Bac_DNA_binding) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCCAGATCGCCGCCAGCAAGGTGGGTTGGCTCGAGGATGCAGCAAGC |
| Internal bar code: | ACGTGGCCGTAGATTAATCCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1706 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCGACCGCTTTACTTCTT |
| Suggested primer 2: | CTAAACCCGAACCCTGGTCC |