| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.002811 |
| Chromosome: | chromosome 16 |
| Location: | 6460276 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g674950 | POD2 | Putative all-trans-retinol 13%252C14-reductase; (1 of 3) 5.2.1.13 - Prolycopene isomerase / CRTISO | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAAGGGACTGGACCGGCGCAGGTGGGGTGCAGAGGAGGATGTGGGCG |
| Internal bar code: | AGCTTGCTATTTTTAGCGTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4190 |
| LEAP-Seq percent confirming: | 99.2647 |
| LEAP-Seq n confirming: | 135 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 136 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGGCTCCAAACACATCGC |
| Suggested primer 2: | TGATGCCTTGCAACGTGTTG |