Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.002815 |
Chromosome: | chromosome 16 |
Location: | 2758211 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g662150 | CPLD51,CCB1 | conserved protein required for cyt b6 assembly; (1 of 1) PF12046 - Protein of unknown function (DUF3529) (DUF3529) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGAAACAAGCCCGCTCGCACGGGCTCCTGCCTCGCGGCTGCCTCGCGG |
Internal bar code: | TTAAACCCCGTGTGGTGGCTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 494 |
LEAP-Seq percent confirming: | 90.9091 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAAGGAGGAGATCGAGCG |
Suggested primer 2: | CCGCTGAGTTTGAAGTGCAC |