Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.003085 |
Chromosome: | chromosome 12 |
Location: | 565848 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g493950 | PRPS13 | Chloroplast ribosomal protein S13; (1 of 1) K02952 - small subunit ribosomal protein S13 (RP-S13, rpsM) | outside_mRNA |
Cre12.g494000 | CGL82 | (1 of 2) IPR002083//IPR008974 - MATH/TRAF domain // TRAF-like; Conserved, expressed protein with meprin and TRAF homology domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAAAGCTTGCAGTCAAGAATGTAAGTGTCAAAGCCGAAGCGGAGTGCTG |
Internal bar code: | TGGTAGAATAGGGGTAGGTTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4279 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 48 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGAGGACTTCGCACACAT |
Suggested primer 2: | AACTTCAGCAGCGTGGCTAT |