| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.003157 |
| Chromosome: | chromosome 7 |
| Location: | 4617235 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g344350 | TPP1 | Chloroplast thylakoid processing peptidase; (1 of 1) K03100 - signal peptidase I (lepB) | outside_mRNA |
| Cre07.g344400 | (1 of 3) 1.1.1.95 - Phosphoglycerate dehydrogenase / Phosphoglyceric acid dehydrogenase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGAGACGCCGTGCGGCCCTAACTCATTTAAAGTTGAATGAAATACGCC |
| Internal bar code: | ACACAGACGTACATGGATAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1607 |
| LEAP-Seq percent confirming: | 88.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCCCAAGGAGAACATCGT |
| Suggested primer 2: | AAACTCCACACGGCAAATGC |