| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.003221 |
| Chromosome: | chromosome 7 |
| Location: | 298158 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g314150 | ZDS,ZDS1 | (1 of 1) 1.3.5.6 - 9,9'-di-cis-zeta-carotene desaturase / Zeta-carotene desaturase; Zeta-carotene desaturase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGAGCCATCACATGCTATGAAGCAAGCGATGGTGTCGGACATGTCGAG |
| Internal bar code: | GGGTAAGGTTCATGCCAGGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2301 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGGAAGATGGCGTGACTG |
| Suggested primer 2: | TTTCACGCATCTGCAGGACT |