| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.003378 |
| Chromosome: | chromosome 9 |
| Location: | 2273765 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394750 | PRPS1 | (1 of 2) PTHR10724 - S1 RNA-BINDING DOMAIN-CONTAINING PROTEIN 1; Chloroplast Ribosomal Protein S1 | 3'UTR |
| Cre09.g394800 | MITC16, MCP16 | Mitochondrial substrate carrier protein; (1 of 3) K05863 - solute carrier family 25 (mitochondrial adenine nucleotide translocator), member 4/5/6/31 (SLC25A4S, ANT) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGGCAATTGGTTTTCGCATTTTACTTGGGGACCGCCGTCGCGTGTGTG |
| Internal bar code: | CATTGAGAACTGTCAGACTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2121 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACCAGGCCGAGAGACAAA |
| Suggested primer 2: | GGAAGACAGGGTTGGTGAGG |