| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.003421 |
| Chromosome: | chromosome 12 |
| Location: | 7610642 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g555951 | PYRD1,RFD1 | putative riboflavin metabolism-associated deaminase; (1 of 2) 3.5.4.26 - Diaminohydroxyphosphoribosylaminopyrimidine deaminase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGGGTAGAGGGCGGGGATCCACGCAGCCTATCAAGTGCATGGGACGGC |
| Internal bar code: | AATGTGCTTTCATAATCTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2526 |
| LEAP-Seq percent confirming: | 94.8718 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACGCAGCGAGTATGATCC |
| Suggested primer 2: | CCACAGCACAGACCAAAACG |