| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.003538 |
| Chromosome: | chromosome 9 |
| Location: | 1900959 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397400 | SDR17 | Short-chain dehydrogenase/reductase; (1 of 1) 1.1.1.300//1.3.1.33 - NADP-retinol dehydrogenase / Retinol dehydrogenase (NADP(+)) // Protochlorophyllide reductase / Protochlorophyllide oxidoreductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGTACTCCACGCTGCCTCCGGAAACCTTTGCCGTGGGCCTGCACATG |
| Internal bar code: | TTCAGTCTCCGTAGATGAACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2403 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAGCCTTCGCCTCAAGAG |
| Suggested primer 2: | TATGAGGAGGAAGTGGCCGA |