| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.003623 |
| Chromosome: | chromosome 13 |
| Location: | 2934824 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g583550 | VIP1,VIPP1 | (1 of 2) K03969 - phage shock protein A (pspA); Vesicle inducing protein in plastids 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTGCGAGCATTCACGCGCGAGGGTTGCAGGTTAGGTTCTTGGGGGGAG |
| Internal bar code: | GCCTGGCAGGATCGCAGCGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2862 |
| LEAP-Seq percent confirming: | 93.1034 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCAAAAATGTCGCTGCTT |
| Suggested primer 2: | CTCCCAACCTGACTGACACC |