Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.003840 |
Chromosome: | chromosome 1 |
Location: | 1785506 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g009900 | CDJ3 | Chloroplast DnaJ-like protein 3; (1 of 2) IPR001080//IPR001623//IPR017896 - 3Fe-4S ferredoxin // DnaJ domain // 4Fe-4S ferredoxin-type, iron-sulphur binding domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGCCGGTGTCGAAGGAGGTATCTGGCATGTCGGCGGCTCCGGCCACGC |
Internal bar code: | GATATTATAACAGTTTCATCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3912 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 85 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTACACCCGTGTCCTGCTTC |
Suggested primer 2: | CAGCGCGTTTGGTGTACAAA |