| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.003877 |
| Chromosome: | chromosome 16 |
| Location: | 3010468 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663900 | HMBS,PBGD1 | (1 of 2) 2.5.1.61 - Hydroxymethylbilane synthase / Uroporphyrinogen synthetase; Porphobilinogen deaminase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCGAACGTATCGATACCGTAGATGAACTGAGCCCCGCGGCCGAGTGA |
| Internal bar code: | ACTGAGACCGGGCAGCGCGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1569 |
| LEAP-Seq percent confirming: | 54.3478 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTCTGTGTACATGGCTGT |
| Suggested primer 2: | GCTTTTGACTTGACGCGTGT |