Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.004037 |
Chromosome: | chromosome 8 |
Location: | 1649641 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g365900 | LHCSR1,LI818 | (1 of 3) PTHR21649//PTHR21649:SF15 - CHLOROPHYLL A/B BINDING PROTEIN // SUBFAMILY NOT NAMED; Stress-related chlorophyll a/b binding protein 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACCATGCCTGCCACTAAACAAACTCGTGCCTGACTGTCGCGCCATCG |
Internal bar code: | GGTATGGCATCGTCGTAGGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1981 |
LEAP-Seq percent confirming: | 98.4615 |
LEAP-Seq n confirming: | 64 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAACAGCGCGTGTGTAAAA |
Suggested primer 2: | CTCCCCACCCAACAGACTTC |