| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.004112 |
| Chromosome: | chromosome 12 |
| Location: | 3711854 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g513950 | SUFD1,SUF4,SUFD | Iron-sulfur cluster assembly protein; (1 of 1) K09015 - Fe-S cluster assembly protein SufD (sufD) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCGCAATGAACCCTGAAACGTCTCACTCAGTCACTCTCCCCAGATAGA |
| Internal bar code: | AGGTTGTTTAATAAGTCATGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1777 |
| LEAP-Seq percent confirming: | 1.5873 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 62 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTAATGGGCTGCTGGCAAT |
| Suggested primer 2: | CGACGACACGGGATGTAGAG |