| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.004186 |
| Chromosome: | chromosome 7 |
| Location: | 2456223 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329150 | SPL21,SPLH1 | DEAH-box helicase, possible nuclear pre-mRNA splicing factor, N-terminal; (1 of 3) K12818 - ATP-dependent RNA helicase DHX8/PRP22 (DHX8, PRP22) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCATCCGAGCGCTACTGAGCTATACGTGATCATCTTACTGACGTTAC |
| Internal bar code: | TAGTTGCCTAGGTACTGGTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 50.9434 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAAGCCTCGGAACACGTT |
| Suggested primer 2: | CCATTCCTTGACGTCCTGCT |