Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.004248 |
Chromosome: | chromosome 3 |
Location: | 2154499 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g156900 | LHCBM5 | (1 of 6) K08912 - light-harvesting complex II chlorophyll a/b binding protein 1 (LHCB1); Light-harvesting Chlorophyll a/b binding protein of LHCII | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTTCACCTTCAGCTCAGCGAAAGCATCGGGGTCCTCAGCCAGGCCCA |
Internal bar code: | GGTCGGCGCTGTCGCTACGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3169 |
LEAP-Seq percent confirming: | 95.0 |
LEAP-Seq n confirming: | 38 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGAACGGTGCGTGATTTGC |
Suggested primer 2: | CTCGGTCCACGGTATGTACG |