Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.004305 |
Chromosome: | chromosome 3 |
Location: | 3940486 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g171179 | (1 of 226) IPR012337 - Ribonuclease H-like domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGAGGGGGGGCGAGGGGGCGGCCAGGGAGGCGGCAGAGCGGCAGGAGC |
Internal bar code: | AGATTTCCGCTTGGGAGTAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 881 |
LEAP-Seq percent confirming: | 57.1429 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCACCCTCCACCGATTC |
Suggested primer 2: | GCGTGGCATGCAGTAATCTG |