| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.004399 |
| Chromosome: | chromosome 2 |
| Location: | 1287642 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g082300 | SUR6 | (1 of 1) PF04935 - Surfeit locus protein 6 (SURF6); Surfeit 6-like protein | 3'UTR |
| Cre02.g082350 | CUTA1,CUT1 | (1 of 1) K03926 - periplasmic divalent cation tolerance protein (cutA); Copper-binding protein CutA | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGTGGCACTTGGCCTAGCACACCACAACAAATTTGACATGAGCCCCT |
| Internal bar code: | TTTACGGATGTATTTGTCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4720 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 98 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 98 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGATTGACGGTTGCTCCT |
| Suggested primer 2: | GCTAAACAACGCCAACAGGG |