| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.004550 |
| Chromosome: | chromosome 9 |
| Location: | 3047737 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393728 | (1 of 3) K05302 - SET domain-containing protein 6 (SETD6) | 3'UTR | |
| Cre09.g393765 | LMR1 | (1 of 14) PF01476 - LysM domain (LysM); Predicted protein with LysM domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCGTGCGAGTCTTATGCGGCAGTCCAAGGGCAGCGCTGTCCGCGCTA |
| Internal bar code: | GCCTCATTTGAGCAGTGCAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1503 |
| LEAP-Seq percent confirming: | 62.5 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTGACTCGCCCTTATCT |
| Suggested primer 2: | TGCGGATTGCCAAACAACTG |