Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.004596 |
Chromosome: | chromosome 3 |
Location: | 4502436 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g175850 | EEP1 | (1 of 1) K10771 - AP endonuclease 1 (APEX1); putative exodeoxyribonuclease III | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGGAAGCGTCCTCCCCGCCCCCGCCCCGCCGACCTTCTTCAGCAGCG |
Internal bar code: | GTCACGCGGTTCCGGTTCAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1336 |
LEAP-Seq percent confirming: | 69.5652 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGGAATTGGGGCTTTAGGC |
Suggested primer 2: | CCCCAGATGCACTTCCATGT |