Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.004600 |
Chromosome: | chromosome 10 |
Location: | 2259092 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g433950 | (1 of 2) PTHR33222:SF3 - PROTEIN CURVATURE THYLAKOID 1C, CHLOROPLASTIC | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAAACTGTAGGCATTCTGCTCAGCCTGAAACCTTGTCTGCCCTCCTGT |
Internal bar code: | CGGCGGTGATTGGCTCGAGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1532 |
LEAP-Seq percent confirming: | 97.561 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGAATTGCACACGGCCAAA |
Suggested primer 2: | CGATCCTCGTCGTGTACAGG |