Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.004806 |
Chromosome: | chromosome 12 |
Location: | 1428218 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g488500 | ARC6 | Accumulation and replication of chloroplast; (1 of 2) PTHR33925//PTHR33925:SF3 - FAMILY NOT NAMED // PROTEIN ACCUMULATION AND REPLICATION OF CHLOROPLASTS 6, CHLOROPLASTIC | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATTCATGTCCTAACACTTCTCCGCCCATGTCCTAAACATCACGGTGCT |
Internal bar code: | CTCATTAGCTGCCCACACCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1871 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACATGCTCAAGGCCATCG |
Suggested primer 2: | ACTGCACGTAAATCCCAGGG |