| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.004835 |
| Chromosome: | chromosome 16 |
| Location: | 1282351 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g651400 | (1 of 37) PF13639 - Ring finger domain (zf-RING_2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGCGGCTGTCCTACGCCTACGACGCCGTGGCACCCAGCTGCTGGGCTG |
| Internal bar code: | ATCTATTCAAACATACTGTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2519 |
| LEAP-Seq percent confirming: | 78.5714 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGTGCGGTTGAAGGAGAT |
| Suggested primer 2: | CTCCCTTTGCCCCAAATTGC |