| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.005082 |
| Chromosome: | chromosome 12 |
| Location: | 7610033 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g555951 | PYRD1,RFD1 | putative riboflavin metabolism-associated deaminase; (1 of 2) 3.5.4.26 - Diaminohydroxyphosphoribosylaminopyrimidine deaminase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGCGCACTAAGCGGAGGTAGCTAGACCTGGAAGTGTGGGCTTGAGTA |
| Internal bar code: | TTACCTCGACAAACAATTGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 954 |
| LEAP-Seq percent confirming: | 77.7778 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGCCACTCCGAAGTCTT |
| Suggested primer 2: | CCTCTACCCTCGAGTCCCAA |