| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.005236 |
| Chromosome: | chromosome 6 |
| Location: | 5369732 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285250 | LHCBM6 | (1 of 6) K08912 - light-harvesting complex II chlorophyll a/b binding protein 1 (LHCB1); Light-harvesting Chloropyll a/b binding protein of LHCII type I, chloroplast precursor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCGTTGAGTTCTATGGCCCCAACCGCGCCAAGTGGCTGGGTAAGTTG |
| Internal bar code: | TGCGAAATGGGGCGGAGCTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1380 |
| LEAP-Seq percent confirming: | 90.0 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCCGCTTGCATGATTTAC |
| Suggested primer 2: | AACGCATTTGCAGTTGGGTC |