Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.005383 |
Chromosome: | chromosome 2 |
Location: | 5227615 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g112300 | MOT15,CAL3 | Calpain family cysteine protease; (1 of 2) K08582 - calpain-15 [EC:3.4.22.-] (CAPN15) | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCAGCTGGGCGACTGCTGGCTGATGAGCGCCCTGGCGTGCCTGGCGT |
Internal bar code: | CTGCCCTGGTTGCGGAGAGGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 193 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTTGATGAGGCTGAGGTGC |
Suggested primer 2: | CACCCCTACAGGACAGCAAG |