| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.005530 |
| Chromosome: | chromosome 7 |
| Location: | 426627 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g315100 | (1 of 2) 1.5.4.1 - Pyrimidodiazepine synthase | outside_mRNA | |
| lncRNA_TCONS_00046952 | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTCGTGCCATCGGCCGTCAGACGCCGCGACAAGCCGCGCAGCCACTAA |
| Internal bar code: | TTCGAATAGTTGATTCGGAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1028 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCACCTCTCTCCTCTCT |
| Suggested primer 2: | GCAAGAATCAGCGCGAAGAG |