| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.005553 |
| Chromosome: | chromosome 3 |
| Location: | 4760913 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g177700 | NIT2 | Transcription factor regulating nitrogen metabolism; (1 of 1) IPR001932//IPR003035 - PPM-type phosphatase domain // RWP-RK domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATGCCGGAGTGCACGCACGACGGCACCATAGTGCTCAGCTGTCAGGT |
| Internal bar code: | TATACTTTTAAGTTTATTCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2478 |
| LEAP-Seq percent confirming: | 86.6667 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGGTCTGTTGCTGCTTTG |
| Suggested primer 2: | GCCACTTAGCTTGCGCATAC |