| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.005570 |
| Chromosome: | chromosome 3 |
| Location: | 1451101 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g151150 | 3'UTR | ||
| Cre03.g151200 | CGLD16 | Conserved in the Green Lineage and Diatoms; (1 of 1) PTHR36343:SF1 - EXPRESSED PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAACGCTGTAATCTCACAGCGCGTCTCGCAAGTCCAGGTCCGGATTGGT |
| Internal bar code: | TTGACGCTACTCGCAAGAGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2249 |
| LEAP-Seq percent confirming: | 97.2973 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGATAAGGCCACACGTGTT |
| Suggested primer 2: | GTCGATAACTCCCTGAGCGG |