Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.005582 |
Chromosome: | chromosome 12 |
Location: | 2109941 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g510034 | (1 of 8) PF13432 - Tetratricopeptide repeat (TPR_16) | 3'UTR | |
Cre12.g510050 | CTH1,CHL27B,CTH1B,CTH1A | Copper target homolog 1, chloroplast precursor%252C functional variant; (1 of 2) 1.14.13.81 - Magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase / Mg-protoporphyrin IX monomethyl ester oxidative cyclase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTATGCGGCACGTGACCACGCAGTCCGGCCGTTGTGCAAATTGTTTGGAA |
Internal bar code: | ACACCGCGGTCCAGAACAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1992 |
LEAP-Seq percent confirming: | 80.0 |
LEAP-Seq n confirming: | 24 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGATAGTGGCGCAAATGGC |
Suggested primer 2: | CTCTATGCGCAGACCTGGAG |