| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.005790 |
| Chromosome: | chromosome 16 |
| Location: | 7015731 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g673617 | PRF1,PRFA1 | Putative chloroplast peptide chain release factor 1; (1 of 2) PTHR11075:SF9 - PEPTIDE CHAIN RELEASE FACTOR 1, MITOCHONDRIAL-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCGCCGGACCCCGTCCTACCCCGTGATTCTCCGCAATCGCATCAAA |
| Internal bar code: | CTTTGAATCGGTGGATAGATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2209 |
| LEAP-Seq percent confirming: | 15.0442 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 96 |
| LEAP-Seq n unique pos: | 113 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTGGCTGGGTTGATAACG |
| Suggested primer 2: | GGCGCGACCATTGTTATGAC |