| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.005807 |
| Chromosome: | chromosome 1 |
| Location: | 5360092 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g037800 | TRL7,TRX21 | (1 of 11) IPR012336//IPR013766 - Thioredoxin-like fold // Thioredoxin domain; Thioredoxin-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTTTTGCCCCGCGTCCTCCGCCACGGGACTACTGCGCCACCTCCCTC |
| Internal bar code: | AGGTATTTGGAAGGGGTGATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5140 |
| LEAP-Seq percent confirming: | 98.9796 |
| LEAP-Seq n confirming: | 97 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 98 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTAGGCATGCAGCTATCT |
| Suggested primer 2: | GACTTCCTGGTCGCTTGTGA |