| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.005811 |
| Chromosome: | chromosome 17 |
| Location: | 4502405 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g731350 | SDR28 | Short-chain dehydrogenase/reductase; (1 of 1) 1.1.1.184//1.1.1.189//1.1.1.197 - Carbonyl reductase (NADPH) / Xenobiotic ketone reductase // Prostaglandin-E(2) 9-reductase / Prostaglandin-E2 9-reductase // 15-hydroxyprostaglandin dehydrogenase (NADP(+)) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCATGGCGCGCAGTTGAGCAAGGCAAGGCGGCCGTGGCCAAGATCA |
| Internal bar code: | ATGGCGAATCGTCGAAGATACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2517 |
| LEAP-Seq percent confirming: | 88.4615 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTAAACGCGCACAATAGG |
| Suggested primer 2: | GCATCGTTCCTCGTGCATTC |