| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.006006 |
| Chromosome: | chromosome 6 |
| Location: | 1009422 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256750 | FAT1,TEH9 | Acyl carrier protein thioesterase; (1 of 1) K10782 - fatty acyl-ACP thioesterase A (FATA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGACAGGCCCTCAGACAACACTGTTGCGCATGTACCCTCCCCCGCCC |
| Internal bar code: | CGTGTTGAATAATTAGACGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 949 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGACCAATACCACCGCGTT |
| Suggested primer 2: | CCCCTACACCCTACTCAGCT |