| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.006108 |
| Chromosome: | chromosome 16 |
| Location: | 2667210 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g661550 | (1 of 1) PF06941 - 5' nucleotidase, deoxy (Pyrimidine), cytosolic type C protein (NT5C) (NT5C) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTCCCTGCTTGCGGCCCCTGCACATTTGGTTTTCGAACTGCACACATG |
| Internal bar code: | AATCACATCACGACTACCTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4080 |
| LEAP-Seq percent confirming: | 90.625 |
| LEAP-Seq n confirming: | 58 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCTGGGGTCCATGATTTG |
| Suggested primer 2: | GCAGTCAATGTTGTGTGCGT |