| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.006121 |
| Chromosome: | chromosome 13 |
| Location: | 909674 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g567750 | PRP18 | Pre-mRNA splicing factor; (1 of 1) K12817 - pre-mRNA-splicing factor 18 (PRPF18, PRP18) | 5'UTR |
| Cre13.g567800 | PPP41,PP2A2 | (1 of 1) K11584 - serine/threonine-protein phosphatase 2A regulatory subunit B' (PPP2R5); Protein phosphatase 2A regulatory B subunit | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACTAGGCTCGCCACTGCCTTAGTTGGACTATACTGACCTACCACGTGC |
| Internal bar code: | TGTTTTGCAGTAAGTACATTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2391 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTTGATTTCCTTCTCGCG |
| Suggested primer 2: | ATGAATCATGTTGGGGCCGT |