| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.006445 |
| Chromosome: | chromosome 9 |
| Location: | 1902113 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397400 | SDR17 | Short-chain dehydrogenase/reductase; (1 of 1) 1.1.1.300//1.3.1.33 - NADP-retinol dehydrogenase / Retinol dehydrogenase (NADP(+)) // Protochlorophyllide reductase / Protochlorophyllide oxidoreductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGTACGCAAATATTCCGCGCCTAACTTGTCCGCCCGTCCTGTGGCGC |
| Internal bar code: | ATCTTATTCGACGGTCTGGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 177 |
| LEAP-Seq percent confirming: | 55.5556 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGCCACTTCCTCCTCATA |
| Suggested primer 2: | CGAAGGAAGATACGAGCGCT |