| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.006466 |
| Chromosome: | chromosome 12 |
| Location: | 2107880 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510050 | CTH1,CHL27B,CTH1B,CTH1A | Copper target homolog 1, chloroplast precursor%252C functional variant; (1 of 2) 1.14.13.81 - Magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase / Mg-protoporphyrin IX monomethyl ester oxidative cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGACATCAGGGTGAAGATCTCCGCGACCACAGGGTTCGTGGCCTTCAG |
| Internal bar code: | ATTGAAGTCGCGTCTCAACGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4499 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 94 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 94 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCAAGGTTATGCGCGACG |
| Suggested primer 2: | CAGCCGACTCGCAATATCCT |