Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.006772 |
Chromosome: | chromosome 17 |
Location: | 1747653 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g708700 | HTR20,HTR27 | Histone H3; (1 of 35) K11253 - histone H3 (H3) | gene_edge/mRNA_edge/5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGATAAAAGTTACTTTTGAGTTCTATATGAGACTTTCCTTCTGGGTAAA |
Internal bar code: | TCTGATAAATCATGTACGTGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4970 |
LEAP-Seq percent confirming: | 98.3607 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGATAGCGGGCTTGGTAAT |
Suggested primer 2: | GCCCCATCCCAACCCATTAA |