| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.006869 |
| Chromosome: | chromosome 8 |
| Location: | 2555383 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g372950 | IDS1,IDS | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; (1 of 1) 1.17.1.2 - 4-hydroxy-3-methylbut-2-enyl diphosphate reductase / HMBPP reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATACCTATCGCTGCTGCAGGTCAAGATGGACGAGCACGGTGTGGGCTA |
| Internal bar code: | GGGAATACGGCAAAATCCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 398 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCCACAAGCTCTCAGCCT |
| Suggested primer 2: | GAGGGCTGAGTGTATCTCGC |