Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.006936 |
Chromosome: | chromosome 17 |
Location: | 422211 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g698750 | RAA12,OPR104 | psaA mRNA trans-splicing factor of subcomplex I; (1 of 781) IPR000104 - Antifreeze protein, type I | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTAAGGCCGCGTTGTTCTCATACAGGCAACGCCATCAACTGCACAAGA |
Internal bar code: | CTTACGATGAAATAGATTGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 453 |
LEAP-Seq percent confirming: | 90.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGTGAACGGTGTGCGTTG |
Suggested primer 2: | AGCTTGTGGAGTTGATGGGG |