| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.006954 |
| Chromosome: | chromosome 10 |
| Location: | 2448370 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435400 | (1 of 1) PF03398 - Regulator of Vps4 activity in the MVB pathway (Ist1) | 3'UTR | |
| Cre10.g435450 | CPL2 | (1 of 9) PTHR10071 - TRANSCRIPTION FACTOR GATA GATA BINDING FACTOR; transcription factor-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGAACTGCACAGGGAGGCAGTGGCGGGACGGCGTTTTGAGGGCACGAG |
| Internal bar code: | CACTGCATAGGATCTTTGCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2718 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATTGAAAGACTTGCGGC |
| Suggested primer 2: | TGGCTGTGTCCTTCGAGTTC |