| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.007167 |
| Chromosome: | chromosome 16 |
| Location: | 4331349 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g668900 | A3,MTA3 | Hypothetical protein; (1 of 2) PTHR11266:SF41 - PXMP2/4 FAMILY PROTEIN 2 | CDS |
| Cre16.g668950 | CPZ | (1 of 1) 3.4.17.1 - Carboxypeptidase A / Carboxypolypeptidase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGCAGACTGAGCGAGTTCCATGGTTTGCCTGGGTCCATCTTTCTAGG |
| Internal bar code: | AATGAGCCGATAAATGATAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 197 |
| LEAP-Seq percent confirming: | 4.54545 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTCCCAGTAACGTCCAGG |
| Suggested primer 2: | ATGAAGCATCCCACCACCTG |