| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.007230 |
| Chromosome: | chromosome 17 |
| Location: | 1823234 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g709350 | SYP5 | Qc-SNARE protein, Syn8/Syntaxin8-family; (1 of 1) K08503 - syntaxin of plants SYP5 (SYP5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGTGTAGTTGGGTATGGAATGCACTGCCTCCTCCCTCCTCCCTCCTCC |
| Internal bar code: | CGACGTGTGAGAGAGCAAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1100 |
| LEAP-Seq percent confirming: | 85.4545 |
| LEAP-Seq n confirming: | 47 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGACACGCAGACACAAGG |
| Suggested primer 2: | TACAACCACGAACCAGCCTC |