| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.007260 |
| Chromosome: | chromosome 12 |
| Location: | 8614425 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g548400 | LHCBM2 | (1 of 3) K08913 - light-harvesting complex II chlorophyll a/b binding protein 2 (LHCB2); Light-harvesting protein of photosystem II | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTGGGCGTGGATCAGGTTCTCGTTGCCGAGGTAGTTCAGGCCGCCCTC |
| Internal bar code: | TGACGGGCGACGTGCGCGCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3387 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTTGCCTCTCAGCTGAA |
| Suggested primer 2: | GCCAGGCACTCCACTAACAT |