| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.007413 |
| Chromosome: | chromosome 2 |
| Location: | 6797072 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388060 | VDR1 | violaxanthin de-epoxidase related, chloroplast; (1 of 1) 1.10.99.3 - Transferred entry: 1.23.5.1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCAGAGAACAACTATATGGCGTCCTGTGTGTGCGTGTGTGGGGCCTGG |
| Internal bar code: | AACGGTGGATGCTTGAAGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1196 |
| LEAP-Seq percent confirming: | 97.6744 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCCACTAGCTACTCCCCA |
| Suggested primer 2: | TGGTGGTCTTATGACACGCC |