| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007422 |
| Chromosome: | chromosome 3 |
| Location: | 5178195 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g181250 | SNE18,CGLD13 | (1 of 10) PF13460 - NAD(P)H-binding (NAD_binding_10); conserved protein related to nucleoside diphosphate sugar epimerase | 3'UTR |
| Cre03.g181300 | SHKG1,SHK6 | (1 of 1) 2.5.1.19 - 3-phosphoshikimate 1-carboxyvinyltransferase / EPSP synthase; 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase (EC 2.5.1.19) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGAGCTGAGCAGGGCTCAACGCAAGCCGCGAGGCAGCTGCCAGCTGGT |
| Internal bar code: | CTTTCCTGATGACTTAGTTAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2116 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGTTTTTGCGGCAGGTGC |
| Suggested primer 2: | TGTTGAGGTTGGGGTTTGCT |