| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.007543 |
| Chromosome: | chromosome 7 |
| Location: | 2473710 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329300 | MSC1 | Mechanosensitive ion channel; (1 of 1) PTHR30221 - SMALL-CONDUCTANCE MECHANOSENSITIVE CHANNEL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGTGGAGCCCACTGCGCCCAACCCAACACGGTACCCCGTACGCCGTA |
| Internal bar code: | TGGAAGTAACTAGCTCATAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 741 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 105 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTGGGCAACTTTGTGAG |
| Suggested primer 2: | GCGTCCAACACTCTCACGTA |